WWW.ДЕНЬСИЛЫ.РФ

БЕСПЛАТНАЯ ЭЛЕКТРОННАЯ БИБЛИОТЕКА - Медицина

 

Pages:     | 1 || 3 | 4 |

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза

-- [ Страница 2 ] --

Выделение суммарной клеточной РНК. Суммарную РНК из фетальных тканей (печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3)) выделяли методом фенольной экстракции. Образцы тканей растирали в ступке с жидким азотом до образования порошкообразной массы. Затем небольшое количество порошка (около 30-40 мкг) быстро переносили в стеклянные гомогенизаторы с денатурирующим раствором (4 М гуанидин тиоцианат (Fluka, Switzerland), 25 мМ цитрат натрия, рН 7,0; 0,5% саркозил (Sigma, USA); 0,1 М 2-меркаптоэтанол (Fluka, Switzerland)) и интенсивно гомогенизировали в течение 5-7 минут. Из полученного лизата отбирали 500 мкл и дальше выделяли РНК по стандартному протоколу. Свежевыделенные мононуклеарные клетки лизировали денатурирующим раствором из расчета 100 мкл денатурирующего раствора на 1Х106 клеток. К лизату последовательно добавляли 0,1 объема 2 М ацетата натрия (рН 4,0); 1 объем насыщенного водой фенола и 0,2 объема смеси хлороформ:изоамиловый спирт (49:1). Перед добавлением очередного компонента лизат тщательно перемешивали, переворачивая пробирки. Конечную суспензию интенсивно встряхивали на шейкере в течение 15 секунд, затем инкубировали на льду 30 мин. После инкубирования образцы центрифугировали для разделения фаз 20 мин при 12000 об/мин. Водную фазу отбирали, добавляли к ней равный объем изопропанола и помещали на -20°С для преципитации РНК. После повторного центрифугирования в течение 20 мин. при 12000 об/мин получившийся осадок РНК дважды отмывали в 75% этаноле. Осадок растворяли в деионизованной воде обработанной диэтилпирокарбонатом (0,01%) (Serva, Germany).

Качество выделенной РНК оценивали с помощью электрофореза в 1% агарозном геле (Chemapol, Чехия), приготовленном на трис-ацетатном буфере. Концентрацию и чистоту РНК оценивали на спектрофотометре "Милихром" при длинах волн 260 и 280 нм.

Реакция обратной транскрипции (ОТ). 10 мкл суммарной РНК денатурировали в присутствии 0,5мкг универсального праймера oligo(dT)16 при 70°С 5 минут и переносили на лед. Реакционная смесь содержала 10 мкл суммарной РНК, 0,5мкг oligo(dT)16 (Биосан, Новосибирск), 500 мкМ каждого dNTP (Sigma, USA), 25ед - M-MuLV обратной транскриптазы (Биосан, Новосибирск). Реакционный буфер прилагался к обратной транскиптазе и содержал 2 мM MnCl2, 20мМ Трис-HCI (рН 8,3 при 25°С), 100мM KCI, 1мМ дитиотрейтол (ДТТ). Реакцию проводили в объеме 20 мкл в течение 1,5 часов при 37°С, денатурировали фермент при 95°С 5 минут. Хранили полученные образцы кДНК при -20° С. Чтобы проконтролировать прохождение реакции ОТ с полученным продуктом и неревертированной РНК проводили ПЦР с праймеров, специфичных к последовательности гена GAPDH.

Полимеразная цепная реакция (ПЦР). ПЦР проводили в амплификаторе “PTC-200 DNA Engine” (MJ Research inc., USA). Реакционная смесь в объеме 20 мкл содержала 2 мкл смеси после реакции обратной транскрипции, 2 ед. Taq-ДНК полимеразы (Сибэнзим, Новосибирск), 0,5 мкМ каждого из праймеров, 250 мкМ смеси четырех dNTP. Реакционный буфер прилагался к ДНК-полимеразе и содержал 60мМ трис-НС1 (рН= 8,5 при 25° С), 100 мМ KCl, 1,5 мМ MgCl2, 10мМ 2-меркаптоэтанола, 1мM ДТТ. Режим термоциклирования зависел от состава праймеров и длины амплифицируемого фрагмента и рассчитывался с использованием программ «Primer Premier 5.0» и «Vector NTI 9.0»

Для повышения специфичности метода проводилась вложенная ПЦР с 1мкл смеси после первичной амплификации с другой парой праймеров. Продукты амплификации анализировали с помощью электрофореза в 1,5 или 2% агарозном геле, приготовленном на трис-ацетатном буфере (ТАЕ). В качестве маркера молекулярного веса использовали гидролизат плазмиды pUC19, полученный при расщеплении рестриктазой MspI (СибЭнзим, Новосибирск), негативными контролями служили препараты «неревертированной РНК» и реакция «без матрицы». После проведения электрофореза гель окрашивали водным раствором бромистого этидия (0,5 мкг/мл). Продукты полимеразной цепной реакции визуализировали в ультрафиолетовом свете, молекулярный вес фрагментов и интегральная оптическая плотность бэндов (IOD) оценивалась с помощью видеоденситометра и пакета прикладных программ “ImageMaster&VDS”(Pharmacia Biotech, USA).

Праймеры к последовательности гена GAPDH, LIF-D, LIF-M, LIF-T были синтезированы в фирме «Биосан», г. Новосибирск. Структура праймеров и термопрофили для первичной ПЦР были следующие:

LIF-D: 5’ – ataatgaaggtcttggcggcag

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-M: 5’ – ctggaagcgtgtggtctg

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 61°C – 25 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-T: 5’ – cacctttcactttccttcctcc

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 62°C – 30 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – ccgaagggatctgcaggaatc

5’ – gtagcttacacttcttgaaactctctctc

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 65°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

Для вложенной ПЦР структура праймеров и режимы термоциклирования были следующими:

LIF-D: 5’ – agtgccaatgccctctttatt

5’ – caaggtacacgactatgcggta



LIF-M: 5’ – gcagtgccaatgccctct

5’ – caaggtacacgactatgcggta

LIF-T: 5’ – cacccacctgcctatgacc

5’ – caaggtacacgactatgcggta

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 20 сек, 20 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – aaatcattcaagagcccagaaccc

5’ – ccagtataaggctccaaaagcaa

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 62°C – 30 сек, 72°C – 20 сек, 25 циклов, 72°C – 3 мин, 25°C – 10 сек.

Статистический анализ результатов. Статистическую обработку результатов исследования проводили, используя анализ таблиц частот и критерий х-квадрат в программе статистической обработки «Statistica 6.0».

РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Экспрессия изоформ мРНК лейкемия-ингибирующего фактора в различных фетальных тканях человека.

В ранее выполненных исследованиях разных авторов экспрессия изоформ LIF в фетальных тканях изучалась лишь у мышей [Haines, 1999]. В нашей работе экспрессию изоформ мРНК LIF исследовали в различных фетальных тканях человека. Для этого получали образцы суммарной РНК, выделенной из ткани печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3).

При анализе продуктов амплификации проводили электрофорез в агарозном геле на каждую изоформу отдельно. В результате вложенной ПЦР транскрипта LIF-D получался продукт размером 166 пар нуклеотидов, LIF-M – 168 п.н. На рисунке 1 проиллюстрированы результаты электрофореза продуктов амплификации LIF-D и LIF-M в различных образцах фетальных тканей и мононуклеарных клетках пуповинной крови новорожденных.

А

Б

По результатам анализа продуктов амплификации в агарозном геле было выявлено, что экспрессия изоформ мРНК LIF имеет неоднородный характер и встречается не во всех исследуемых тканях. В таблице №1 приведены значения частот встречаемости изоформ LIF в фетальных тканях человека.

Для определения значимости различий в частотах встречаемости экспрессии изоформ был произведен статистический качественный анализ таблиц частоты определения экспрессии по критерию хи-квадрат.

Таблица 1.

Частота встречаемости альтернативных транскриптов LIF в фетальных тканях плодов 20-22 недель гестации.

Изоформы LIF hLIF-D раствор. hLIF-M мембр. hLIF-T
Фетальные ткани
Печень 7/7 (100%) * 3/7 (42.86%) 0/7
Тимус 1/6 (16.67%) 0/6 (0%) 0/6
Селезенка 0/5 (0%) 2/5 (40%) 0/5
Яичники 1/5 (20%) 1/5 (20%) 0/5
Семенники 1/4 (25%) 1/4 (25%) 0/4
Почка 0/5 (0%) 0/5 (0%) 0/5
Надпочечники 3/3 (100%) 2/3 (66.67%) 0/3
Мозг 2/7 (28.57%) 5/7(71.4%) 0/7
Зачатки зубов 2/3 (66.67%) 1/3 (33.33%) 0/3
Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.* -p<0,05 между изоформами.


Pages:     | 1 || 3 | 4 |
 


Похожие работы:







 
2013 www.деньсилы.рф - «МЕДИЦИНА-ЛЕЧЕНИЕ-ОЗДОРОВЛЕНИЕ»

Материалы этого сайта размещены для ознакомления, все права принадлежат их авторам.
Если Вы не согласны с тем, что Ваш материал размещён на этом сайте, пожалуйста, напишите нам, мы в течении 1-2 рабочих дней удалим его.